Gerda Prantl: Sensing the Other

Sensing the Other – Von Fingermorphs, Berührungspunkten und anderen Kollisionen

Die Werkreihe Sensing the Other hat Ende 2019 ihren Anfang genommen und scheint sich, in dieser aktuellen Ausbreitungs- und Eingrenzungsphase von „Corona“ und dem einhergehenden „Social Distancing“, 2020, mit ihrer Verortung von Sehnsuchtsphantasien nach Akten der Berührung in Malerei und Zeichnung, umso mehr zeitgenössisch zu behaupten.

Die Morhps aus zwei „Dauerbrenner-Elementen“ der Malerei, nämlich der menschlichen Hand, genauer den Digiti manus oder Fingern und dem Granatapfel, auch Punica granatum, mutieren über Korallen-, Raupen-, Käferartige sowie einzelne Buchstaben, Silben und Wortgebilde hin bis zur nunmehr bekannten Strahlenform des genannten Virusstamms. Der zeichnerisch-malerischen Bildsprache von vernetzten Strukturen geht eine Beschäftigung mit Kupferstichen in Enzyclopädien wie etwa Metamorphosis insectorum Surinamensium oder Lithographien in Kunstformen der Natur, aber auch Filmen wie Historia Naturae, voraus. Neben „the Other“ oder „dem Anderen“ als dem fehlenden und sehnsüchtig vermissten Gegenüber, wird es in den Arbeiten zu Sensing the Other auch als das Fremde und Unbekannte begriffen, dessen in Erfahrung bringen, Begreifen und Berühren ebenso begehrt wird.

In der digitalen Bildwelt werden beim „Morphing“ bekannterweise Übergänge zwischen Einzelbildern geschaffen, Morphs in der Welt der Sprache hingegen stellen die kleinste Bedeutungseinheit dar und entstehen durch Segmentierung von Wörtern. Erneut aneinandergereiht, können diese eine Sequenz ergeben, den Begriff der DNA-Sequenzierung aus der Genomik widerum definiert man als ein Ablesen der Nukleotidfolge in einem DNA-Molekül. Ein Artikel der New York Times vom 3. April 2020 spricht von der Dechiffrierung des Genoms von SARS-CoV-2 im Jänner 2020: „Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic. “* Dieses „virale Rezept“ bestehe aus weniger als 30 000 Buchstaben oder „Letters“, wovon die erste Sequenz sich wie folgt liest beziehungsweise visualisiert:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacacucggcugc
augcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccgug
uugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

Inspiriert von dieser Darstellung werde ich mich in weiteren Veranschaulichungen und Bildtafeln versuchen, um Aspekte der Annäherung an kollidierende und sich vereinigende Welten unter die Lupe zu nehmen.

*New York Times (Hg.) (2020): Bad News Wrapped in Protein: Inside the Coronavirus Genome. Online unter: https://www.nytimes.com/interactive/2020/04/03/science/coronavirus-genome-bad-news-wrapped-in-protein.html (17.04.2020)

Text: Gerda Prantl

https://gerdaprantl.tumblr.com/
https://www.instagram.com/gerdaprantl/

Beitragsbild:

Abbildungen:
Sensing the Other: Caterpillarmorphosis
, Tusche auf Leinwand, 60 x 40 cm, 2020
Sensing the Other: CK of Shellshock, Tusche auf Papier, 70 x 50 cm, 2019
Sensing the Other: Fingermorphs invading Blue, Tusche und Acryl auf Leinwand, 100 x 80 cm, 2020